Archives

  • 2019-10
  • 2020-03
  • 2020-07
  • 2020-08
  • br In vivo tumo iframe width height src

    2019-10-21


    2.6. In vivo tumor formation assay
    Male BALB/c mice (six weeks old) were obtained from the Institute of Zoology, Chinese Academy of Sciences, and the animal studies were approved by the Institutional Animal Care and Use Committee of Soochow University. MGC-803 cells transfected with circFAT1(e2) or NC were harvested from 6-well plates, washed with phosphate-buffered saline (PBS), and then resuspended with medium at 2 × 106 cells/mL. Subsequently, 100 μL of suspended MGC-803 cells were injected into the left flank of nude mice. Tumor growth was examined at 0, 7, 21, 28 days after injection; volumes of tumors were measured as the length × width2 × 0.5.
    GC tumor tissues were collected from xenografts in nude mice, fixed with 10% formalin, embedded in paraffin and cut into 4 μm sections. Tissues sections were incubated with primary Iberiotoxin against Ki-67 (Rabbit, 1:50, ab833, Abcam) overnight at 4 °C. Tissues were then in-cubated with secondary antibodies (Goat anti Rabbit, 1:1000, ab6721, Abcam) for 2 h at room temperature.
    2.8. Statistical analysis
    Data in this present study were all expressed as the mean ± SEM. All statistical analyses were carried out using GraphPad (Ver. Prism 7, GraphPad Prism Software, La Jolla, CA, USA) and SPSS 20.0 (IBM, SPSS, Chicago, IL, USA). According to Benjamini and Hochberg, the false discovery rate may be the appropriate error rate to control in many applied multiple testing problems [18]. The two-tailed Student's t-test was used for the analysis of continuous variables. We determined the differences among the three groups by using a nonrepeated mea-sures ANOVA and Scheffe's test. A P value less than 0.05 was considered significant. More detailed Materials and Methods are included in the supplementary file.
    3. Results
    Table 1
    Primer and sequence in this study.
    GENE Primer
    GAPDH TGTTCGTCATGGGTGTGAAC ATGGCATGGACTGTGGTCAT circFAT1 AACAGAAGAGAACTGGGGCG GATCAGGGTGCCAATGGTGA miR-548g ACACTCCAGCTGGGTGCAAAAGTAATTGCAG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAAAAACT U6 CTCGCTTCG GCAGCACA AACGCTTCACGAATTTGCGT EGFR CCAACTATGGGACAAACAGAA ATCGCACAGCACCAATCA CDC25A TCTGAAGAATGAGGAGGAGAC AAA CAG CTT GCA TCG GTT GT c-Met TATGTGGCTGGGACTTTGGA GCT TATTCATGG CAG GACCAA C
    (logFC = 0.046037, P = 0.001511) and hsa_circ_0035431 (logFC = 0.043576, P = 0.000249) were lowest in GSE83521 (Fig. 1A and supplementary Excel-2). Only two circRNAs were consistently downregulated in both datasets: hsa_circ_0067997 and hsa_-circ_0001461 (Fig. 1B). RT-PCR analysis of hsa_circ_0067997 showed no products in MGC-803 cells with divergent primers (Fig. S1A). Therefore, we chose hsa_circ_0001461 for further research. Hsa_-circ_0001461, which was termed circFAT1(e2), arose from the FAT1 gene and consisted of the head-to-tail splicing of exon 2 (Fig. 1C). We designed convergent primers to amplify linear mRNA of exon 10 from FAT1 (linFAT1), as well as divergent primers to amplify circFAT1(e2), to validate the formation of circFAT1(e2). Using cDNA and gDNA as templates, circFAT1(e2) could only be amplified by divergent primers in cDNA, and no products were observed in the gDNA groups (Fig. 1D). Then, the RT-PCR product of circFAT1(e2) was confirmed by Sanger sequencing (Fig. 1E). Moreover, fluorescence in situ hybridization (FISH) against circFAT1(e2) revealed that circFAT1(e2) were not only localized in the cytoplasm but also in the nucleus (Fig. S1B). Actino-mycin D and RNase R exonuclease were used to further validate cir-cFAT1(e2) in MGC-803 cells. Resistance to actinomycin D and RNase R exonuclease confirmed that this RNA species was indeed circular (Fig. 1F and G). We also confirmed the presence of circFAT1(e2) by actinomycin D and RNase R exonuclease in MKN-28 cells (P < 0.05, Figs. S1C and 1D).